Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA.1030 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Gestational Diabetes Mellitus | ICD-10 | Diabetes mellitus arising in pregnancy (O24.4) |
DBLink | Link to database | PMID | 29526755 |
Experimental Method | |||
Sample Type | Placental Villi | Comparison | 30 Gestational Diabetes Mellitus (GDM) cases and 30 normal controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TACTTTTTGCAATTTCCCTCC ReverseCCTCTGGCCTCATTGCTTAG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Yan, L, Feng, J, Cheng, F, Cui, X, Gao, L, Chen, Y, Wang, F, Zhong, T, Li, Y, Liu, L (2018). Circular RNA expression profiles in placental villi from women with gestational diabetes mellitus. Biochem. Biophys. Res. Commun., 498, 4:743-750. |